Journal: G3: Genes|Genomes|Genetics

Article Title: A Collection of Transgenic Medaka Strains for Efficient Site-Directed Transgenesis Mediated by phiC31 Integrase

doi: 10.1534/g3.118.200130

Figure Lengend Snippet: Ac/Ds transposon-mediated integration of an attP site into medaka chromosomes (A) Schematic representation of template vectors for generation of mRNA encoding Activatior , phiC31 integrase or Flippase. (B) Schematic representation of the Ds-attP-mCherry-FRT-Ds vector. Fertilized one-cell-stage embryos were microinjected with 10 ng/µl of this vector together with 25 ng/µl of Ac mRNA to establish attP-landing-site strains. (C) Ninety-one of 261 G 0 embryos microinjected as in (B) survived and were subjected to heat shock at 5 dpf for observation of mCherry fluorescence. The numbers of dead, mCherry fluorescence-negative and -positive embryos are indicated in black, white, and orange columns, respectively. (D) Twenty fertile G 0 fish were crossed with wild-type fish, and 13 were identified as transgenic founders that produced F 1 transgenic offspring carrying the Pzhsp70-mChery-pA at the attP-landing site. (E) F 1 transgenic fish were observed for mCherry fluorescence at 1 day after hatching with or without heat shock. The attP-landing site is in chromosome 13. Scale bar: 1mm.

Article Snippet: The attP-landing vector , Ds-attP-mCherry-FRT-Ds, comprises the 5′- and 3′-Ds ends amplified from pDsDELGT4 ( Quach et al. 2015 ), a tandem repeat of chicken-derived insulator (2xcHS4) , a 165-bp segment of the attP site (5′-GCTTCACGTTTTCCCAGGTCAGAAGCGGTTTTCGGGAGTAGTGCCCCAACTGGGGTAACCTTTGAGTTCTCTCAGTTGGGGGCGTAGGGTCGCCGACATGACACAAGGGGTTGTGACCGGGGTGGACACGTACGCGGGTGCTTACGACCGTCAGTCGCGCGAGCG-3′) from pBCPB+ (Addgene Plasmid 18940) ( Groth et al. 2000 ), a 1.5-kb segment of the zebrafish hsp70 (zhsp70) promoter ( Halloran et al. 2000 ) cloned from the genomic DNA of the zebrafish AB strain, the mCherry-coding sequence and an SV40 polyA signal from pmCherry-N1 (Clontech), a 48-bp segment of a synthetic FRT site (5′-GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC-3′), and a minimal bacterial backbone derived from pPBIS19-mgfc:TagBFP-8xHSE:Cre ( Okuyama et al. 2013 ).

Techniques: Plasmid Preparation, Fluorescence, Transgenic Assay, Produced